Id Trinity | TRINITY_DN25170_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_443922 |
Sequence | CGATGGTGGAATGAGTAACTCAAACTTGTGCATGCAGACTCAAGCAAACATCATCGGCATTCCCGTCGACCGCCCCTCCATGGCCGAGACAACAGCTCTG GGTGCCGCAATCGCCGCCGGTTTTGCAGTCGGTATCTGGAAAGAATTCAACGAGCTCAAGGCCATCAACCAGAAGGACCGCCAAATTTTCTCCCCTGCCG TTTCAAAGGAAGAGAGCGAAAAGATGTTCAGCAAGTGGGAACGTGCCGTCCGAATGTGCAAGGGTTGGTTAGACCCGCAGGACGAGCGCACCGATAACTG AGATATACC BLAST |
Tissue | pods |
Gene name | LI_gene_123931; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_443922
Blastp | Glycerol kinase from Desulfovibrio with 51.69% of identity |
---|---|
Blastx | Glycerol kinase from Desulfovibrio with 51.69% of identity |
Eggnog | Key enzyme in the regulation of glycerol uptake and metabolism (By similarity)(COG0554) |
Kegg | Link to kegg annotations (DvMF_0809) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_003533071.2) |
Pfam | FGGY family of carbohydrate kinases, C-terminal domain (PF02782.15) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |