| Id Trinity | TRINITY_DN25677_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_504572 |
| Sequence | CAAATGAGGATGCAATATGGTTGTGGCTAATGTCAATTGTTTGTGAGATATGGTTTGGATTTTCATGGATACTTGATCAAATTCCGAAGCTTTGCCCTGT CAACCGTTCCACTGACCTTGAAGTTCTCCATGAAAAATTTGATAGTCCGTCACCATCCAATCCCACGGGACGATCCGATCTACCTGGTATGGACCTCTTT GTGTCTACTGCTGATCCTGAAAAAGAGCCAGTTCTTGTCACTGCCAATACAATTCTGTCCATATTAGCTGTTGACTATCCTGTGGAGAAACTTGCTTGTT ATGTTTCTGATGATGGAGG BLAST |
| Tissue | pods |
| Gene name | LI_gene_124094; |
| Additional information | details; |
| PAB | abscising pods |
| PNAB | non-abscising pods |
| PS1 | seeds stages 1-3 |
| PS2 | seeds stages 4-6 |
| PS3 | seeds stages 7-8 |
| PW1 | pods wall stages 1-3 |
| PW2 | pods wall stages 4-6 |
| PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_504572
| Blastp | Cellulose synthase-like protein D4 from Arabidopsis with 89.52% of identity |
|---|---|
| Blastx | Cellulose synthase-like protein D4 from Arabidopsis with 89.52% of identity |
| Eggnog | Glycosyl transferase, family 2(COG1215) |
| Kegg | Link to kegg annotations (AT4G38190) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019454873.1) |
| Pfam | Cellulose synthase (PF03552.13) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |