Id Trinity | TRINITY_DN25750_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_470728 |
Sequence | CAGCGGCGGACGCGGTACCGATCACTTCCAAAACATCCTTTCACAAGCTCGCAACAACGCACCGCGTGCACCTGGTGGCGACGACGACGATGAAGAGGAG CCCGCTGGCCCTTCAAGGCCCAGCAACTTCAGTGGCCGCGCCCAGACCCTCGGAGGCGACGATGCGCCATCTCGTATCGTTGCGGACCCCGCTGCTCCTG TCGCCGGTCGTCGTCCAGGCGCCGCCGCCCTCCCTCGGATCAGCCGCACCATGCATCTCTGGGCCGACGGTGTCAGCATTGACGATGGACCCCTCTTCCG ATTTGACāBLAST |
Tissue | pods |
Gene name | LI_gene_124116; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_470728
Blastp | UBX domain-containing protein 1 from Aspergillus with 40.62% of identity |
---|---|
Blastx | UBX domain-containing protein 1 from Aspergillus with 47.54% of identity |
Eggnog | - |
Kegg | Link to kegg annotations (AN8228.2) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019456914.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |