| Id Trinity | TRINITY_DN25952_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_435504 |
| Sequence | CAAACATGGTACTCCTCCTAGGAGCTTGTCCAGAATATGGTTGTCTTGTCTATGAGCACATGTCACGTGGAAGCTTAGATGATGTCCTTTTCTGTAGAGG AAACAGTCCTGCACTTCCATGGCAACTTAGGTTCAAGATTGTGTGTGAGATTGGAACTGGTTTATTGTTCCTACACCAAACAAAACCTGAACCTCTTGTC CATAGGGACTTAAAACCAGCAAACATATTGCTTGATAGAAACTATGTTGCAAAGATAAGTGATGTAGGTTTGGCTAGGTTAGTTCCACCTTCTGTTGCTA ACAATGTTACTCAATATAG BLAST |
| Tissue | pods |
| Gene name | LI_gene_124178; |
| Additional information | details; |
| PAB | abscising pods |
| PNAB | non-abscising pods |
| PS1 | seeds stages 1-3 |
| PS2 | seeds stages 4-6 |
| PS3 | seeds stages 7-8 |
| PW1 | pods wall stages 1-3 |
| PW2 | pods wall stages 4-6 |
| PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_435504
| Blastp | U-box domain-containing protein 34 from Arabidopsis with 61.9% of identity |
|---|---|
| Blastx | U-box domain-containing protein 34 from Arabidopsis with 61.9% of identity |
| Eggnog | Serine Threonine protein kinase(COG0515) |
| Kegg | Link to kegg annotations (AT2G19410) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019447515.1) |
| Pfam | Protein tyrosine kinase (PF07714.16) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |