| Id Trinity | TRINITY_DN27012_c0_g2_i1 |
|---|---|
| Name Transcript | Ll_transcript_401387 |
| Sequence | TGGATATGTTGTGATGTATATGACACAGGAATTGGAATACCAGAAAAAGGCATACATACTCTATTTAAAAGGTACATGCAAGTCAGTGCAGACCACGCTC GGAAGTATGGGGGCACAGGGCTAGGACTAGCAATATGCAAACAACTGGTTGAGTTAATGGGTGGTCGACTAACAGTGTCTAGCAAAGAACATTGTGGTTC TACCTTCACCTTCATACTTCCATACAAGGTTTCAACCGCTTGTGACGATGATTCTGATGACTTTGATGTGGAGAAAAATGATGGCATGTCTGATGATACA ACACAGGGCTTC BLAST |
| Tissue | pods |
| Gene name | LI_gene_124497; |
| Additional information | details; |
| PAB | abscising pods |
| PNAB | non-abscising pods |
| PS1 | seeds stages 1-3 |
| PS2 | seeds stages 4-6 |
| PS3 | seeds stages 7-8 |
| PW1 | pods wall stages 1-3 |
| PW2 | pods wall stages 4-6 |
| PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_401387
| Blastp | Histidine kinase 5 from Arabidopsis with 68.22% of identity |
|---|---|
| Blastx | Histidine kinase 5 from Arabidopsis with 81.82% of identity |
| Eggnog | Histidine kinase(ENOG410XNMH) |
| Kegg | Link to kegg annotations (AT5G10720) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019458873.1) |
| Pfam | Histidine kinase-, DNA gyrase B-, and HSP90-like ATPase (PF02518.25) |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |