Id Trinity | TRINITY_DN27276_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_401531 |
Sequence | ACTATATTTGCACTTTTGCAATGCACACCTGATTTATCAGAGCAAGACTGCAATAATTGCTTGGTAGCTAGTATCACAGATATCTCAAGTTGTTGTGCTG GCAGAATAAATGGCAGAATTGGAAAACCAAGCTGCAATCTTCGATTCGATACATCACCGTTCTATAACTCTACGGTTAATACCGCTCAACCGCCAGCACC ACAAGTGCCTCCTCCTCCAGTCACTAATACCACTTCCACACAAGGAAAGAGCAACACAACAACAATCATCGTTGCGGTAGTTGTTCCTGTTGTTTCCATT GCTGTGCTGATTATCTTAGTCTGCATCTTCTTAAGAGCAAGGAAGCAATGGGAAAATATTG BLAST |
Tissue | pods |
Gene name | LI_gene_124583; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_401531
Blastp | Cysteine-rich receptor-like protein kinase 29 from Arabidopsis with 41.38% of identity |
---|---|
Blastx | Cysteine-rich receptor-like protein kinase 25 from Arabidopsis with 47.46% of identity |
Eggnog | Serine Threonine protein kinase(COG0515) |
Kegg | Link to kegg annotations (AT4G21410) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019427246.1) |
Pfam | Salt stress response/antifungal (PF01657.16) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |