Id Trinity | TRINITY_DN31103_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_435570 |
Sequence | ACCCTCAAGACAACGCACAGAACCCAGCCGACTTGTGCAACCGTTTCTGCAACACCCTCGACATGGACCAAAAGACCACCAACCTGGCCATCGCCATCGC AACAAAGCTCACGGAGACTGGCGGCCTTGCTGGTCGCTCTCCTCTGTCCGCTGCTTCCGCGTCCATCTACATGGCCGGGCACCTTCCCGGAACTTCCAAG CCAGCCAAGGA BLAST |
Tissue | pods |
Gene name | LI_gene_125734; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_435570
Blastp | - |
---|---|
Blastx | Transcription initiation factor IIB from Methanococcus with 36.51% of identity |
Eggnog | Stabilizes TBP binding to an archaeal box-A promoter. Also responsible for recruiting RNA polymerase II to the pre- initiation complex (DNA-TBP-TFIIB) (By similarity)(COG1405) |
Kegg | Link to kegg annotations (MmarC7_1038) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_013467595.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |