Id Trinity | TRINITY_DN31911_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_499372 |
Sequence | TCTGTTCTGGTCACGGTTTCAAGTTGTTGGCCTCTAACTACCTCGGACTTCACGAGACTTCCGAGAACCCCTTTTACAAGGAAGTCCATGGACTAATAGA GACCACACAGGTTACCCCTGCTGAGGTTGCAGAGGAGCTAATGAAGGATGATGATGCCAATGTTGCTCTTCAAGGACTTGCTGCTTTTCTTAAACGTAAG AGGGTTGAAGAAATTGAAATGAAGGATGAAAGGGTAGATGACCATAAAGTTCATGAAGCCAAGAAATTAAGATCTAATACTGATGTGAGTAGAATTGCTA AAGAAATAGAAGAGCTTCAAGGGATAAGTTTCTATTGAATAGACATTAGTAGCGTTAAGTCTCATGACTATTTTGGTACCTGTTTTAGGAGATTGAGAAA TTATTGāBLAST |
Tissue | pods |
Gene name | LI_gene_125992; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_499372
Blastp | AAA-ATPase At2g18193 from Arabidopsis with 47.37% of identity |
---|---|
Blastx | AAA-ATPase At2g18193 from Arabidopsis with 47.37% of identity |
Eggnog | Acts as a processive, ATP-dependent zinc metallopeptidase for both cytoplasmic and membrane proteins. Plays a role in the quality control of integral membrane proteins (By similarity)(COG0465) |
Kegg | Link to kegg annotations (AT2G18193) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019421799.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |