Id Trinity | TRINITY_DN32671_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_404958 |
Sequence | GTGATATCAACTCTGTCATCATGGACTATCTAGTCTCCGAAGGCTACCCAGGAGCGGCTGAGAAGTTTGCCCTTGAGACCAATCTGTCCCAGGGCGAAAC CTTCGACATCCAAAGCATCCGTGAGCGAGTCGACATTCGAAACGCCATCCTCAGCGGTCGCATTGAGGTGGCTATCGAGCTGCTCAACAATGACGAGACT ATGATCCTAGACACCAACCCTCTCCTCCACTTCAAGTTGATGCAACTTCAGCTTGTCGAGATGATCCGTGCCGTCTACCAGCGCAGCAACGGCAAGCCTG CGTCTGCAGAGTTTCGCTCCGCGCTCGAG BLAST |
Tissue | pods |
Gene name | LI_gene_126239; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_404958
Blastp | Glucose-induced degradation protein 8 homolog from Dictyostelium with 48.31% of identity |
---|---|
Blastx | Glucose-induced degradation protein 8 homolog from Dictyostelium with 48.31% of identity |
Eggnog | GID complex subunit 8 homolog (S. cerevisiae)(ENOG410XRG3) |
Kegg | Link to kegg annotations (DDB_G0279265) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_006597413.1) |
Pfam | LisH (PF08513.10) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |