Id Trinity | TRINITY_DN33791_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_347859 |
Sequence | GAAGCACAGGATGGAAAACGGCTACCACATTTACTCCTTCTCCGGCCAGCTTCTTCGCGAAGAGCCTATTGAGCAATTCAAGCAGTTCGTCTGGCGTCCT CGCCCCGAGCGCCTTCTTAGTAAGGAGGAGATGAAGACTGTTCGCAAGAACCTCCGTGAGTACTCGCGCACCTTCGACGAGGCCGATCTTGCCAAGCGCA GCTCCGCCGACAAGGCCGTTGTCGAGGAGCGCCGCCGTAAGCTCAACGAATGGTTGGCATACCGCGAGCGTACCGTCGAGGACCTCCTCGACGAGCGCCA CGAGCTCCGCCTTCCCGAGATCAGCAACGâBLAST |
Tissue | pods |
Gene name | LI_gene_126570; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_347859
Blastp | Eukaryotic translation initiation factor 3 subunit B from Sclerotinia with 61.9% of identity |
---|---|
Blastx | Eukaryotic translation initiation factor 3 subunit B from Botrytis with 67.05% of identity |
Eggnog | - |
Kegg | Link to kegg annotations (SS1G_04820) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_016180275.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |