| Id Trinity | TRINITY_DN34186_c0_g1_i1 |
|---|---|
| Name Transcript | Ll_transcript_435529 |
| Sequence | GATAATGAGATCAAAAATTTCTGGAACACTCATCTAAAGAAAAAGTTGATTCAGATGGGTTTTGATCCAATGACTCACCAGCCAAGATCGGACCTTGTTT CCACCTTGCCATATCTGCTAGCTCTGGCCAACATAACAGACACTATGGATCATAATCTGTCATTGGATGAACAAGCTCTGGGGTTAACAGCAGAGGCAGT TCAGCTAGCCAAACTTCAATACCTTCATTATTTACTCCAAACTTCAAACTCCTTAAGTACCAATAATTCCTATGACCAAAATGCCATCACAAACATTGAA CCTTTTA BLAST |
| Tissue | pods |
| Gene name | LI_gene_126682; |
| Additional information | details; |
| PAB | abscising pods |
| PNAB | non-abscising pods |
| PS1 | seeds stages 1-3 |
| PS2 | seeds stages 4-6 |
| PS3 | seeds stages 7-8 |
| PW1 | pods wall stages 1-3 |
| PW2 | pods wall stages 4-6 |
| PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_435529
| Blastp | Transcription factor MYB16 from Arabidopsis with 40.48% of identity |
|---|---|
| Blastx | Transcription factor MYB102 from Arabidopsis with 72.73% of identity |
| Eggnog | Myblike DNAbinding domain containing protein(COG5147) |
| Kegg | - |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_003523816.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |