Id Trinity | TRINITY_DN35705_c0_g1_i2 |
---|---|
Name Transcript | Ll_transcript_444645 |
Sequence | AGGAGAGATGCACCACTCGTCCTTCTGGCCCGCCGATGGCGTGCCGACCAAGGGCAAGAGGGTGGCTGTTATCGGCACGGGTTCGACGGGCATCCAGCTC GCACAAGAGGCCGCCAAAGATGCCAAGTCTGTCACGGTCTTCCAGCGCACGCCTAACCTTTGCTTGCCGATGAGACAGCGTAAGCTTACGAAGGAAGAGC AAGATGAGGACAAGAAGACGCGTGCCGAGCTGTACAAGTACAGAATGACGACTTTTGCCGGCTTTGGCTACGATTTCGCCGAGAAGAACACTTTCGAC BLAST |
Tissue | pods |
Gene name | LI_gene_127434; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_444645
Blastp | Cyclopentanone 1,2-monooxygenase from Comamonas with 53.12% of identity |
---|---|
Blastx | Cyclopentanone 1,2-monooxygenase from Comamonas with 53.12% of identity |
Eggnog | - |
Kegg | - |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_012570650.1) |
Pfam | Pyridine nucleotide-disulphide oxidoreductase (PF07992.13) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |