Id Trinity | TRINITY_DN36370_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_425664 |
Sequence | CAAGATTATAGAAACAAAAAATGAGTTTGATGTCATTTATATTTACTATACTTTTATCTTAACAGATCCTAATAGTGAGAGCAGGAGTGGCAGTGTTTAT ATTCCAAGAGATGAAGCTTTTGGTCACTTGAAATCGTCTGATTTTCTTATCTATGGACTGAAGTCTGTAGCACAAGATGTAACTTCTGTGTTACAATCTG TATTTGAATTAGATTTCACACCAAATGAGTTTGAAACCTTTGATGAAGTGAGAGAACTCTATGAAGGAGGAATTAAGCTTCCTACAGATGCAATTAGCAA AATTAGTCCTTTACCAGTGTTGAAGGAAATTTTCGAACCGATGGCGAGCAGTTCCTCAAGTTTCC BLAST |
Tissue | pods |
Gene name | LI_gene_127993; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_425664
Blastp | Seed linoleate 9S-lipoxygenase-3 from Soja with 78.02% of identity |
---|---|
Blastx | Seed linoleate 9S-lipoxygenase-3 from Soja with 78.02% of identity |
Eggnog | Plant lipoxygenase may be involved in a number of diverse aspects of plant physiology including growth and development, pest resistance, and senescence or responses to wounding (By similarity)(ENOG410XT0Q) |
Kegg | Link to kegg annotations (547869) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019443521.1) |
Pfam | Lipoxygenase (PF00305.18) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |