Id Trinity | TRINITY_DN36986_c0_g2_i1 |
---|---|
Name Transcript | Ll_transcript_530981 |
Sequence | CTGCTCGTTATCGACACACCTGGTCACGAGTCTTTCACTAACCTTCGTACTCGTGGTTCATCTCTCTGTAACATTGCCATCTTGGTTGTCGACATCATGC ACGGTCTTGAGCCTCAGACTCTCGAGTCCATGAAGTTGCTGAGAGACCGCAAGACGCCCTTCATTGTCGCACTCAACAAGATCGATCGTCTCTACGGCTG GAAGAAGATCGACAACAACGGTTTCCGGGACTCGCTCGCCATGCAGAACAAGGCCGTTCAGAACGAATTCAGAGACAGACTTGAGAAGACCAAGCTCGCC TTCGCCGAGâBLAST |
Tissue | pods |
Gene name | LI_gene_128539; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_530981
Blastp | Eukaryotic translation initiation factor 5B from Chaetomium with 83.5% of identity |
---|---|
Blastx | Eukaryotic translation initiation factor 5B from Chaetomium with 83.5% of identity |
Eggnog | - |
Kegg | Link to kegg annotations (CTHT_0029840) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019442077.1) |
Pfam | Elongation factor Tu GTP binding domain (PF00009.26) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |