Id Trinity | TRINITY_DN37031_c0_g2_i1 |
---|---|
Name Transcript | Ll_transcript_297612 |
Sequence | GTGGTTCAGCGAGCAGCTTGCGTCTGGTACCACCAAGAACATCAACACCATGGCCGTCTTCCTCACCCTGGCTTACCTGTATGAGAAGACTGGCGAGCAG ACCTACCTCCCATGGCTAGACTCATGGGCGGAATGGGCCATGTATGGCCTGCCCAGGACACCCTTTGATGGCATGCAGCACATGACCTACCTCACGGACA ACCACAATGAGCTTTGGGACGACACCCTCATGATGACTGTGCTTCCTCTCGCCAAGATCGGCAAGCTTCTCAATAGGCCGCATTACATCGAAGAAGTCA BLAST |
Tissue | pods |
Gene name | LI_gene_128599; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_297612
Blastp | Unsaturated rhamnogalacturonyl hydrolase YesR from Bacillus with 31.68% of identity |
---|---|
Blastx | Unsaturated rhamnogalacturonyl hydrolase YesR from Bacillus with 31.68% of identity |
Eggnog | Glycosyl Hydrolase Family 88(COG4225) |
Kegg | Link to kegg annotations (BSU07000) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019438958.1) |
Pfam | Glycosyl Hydrolase Family 88 (PF07470.12) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |