Id Trinity | TRINITY_DN37108_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_318159 |
Sequence | CACACATAACCGCAATCATGGCGCCCGCTGCTTGGGATGATGAGGACTCTGAGAGCACCCCTCCTTCCTCTCCCCCTGTTGTTGCCGCCCGCCGCAGCAA GTTCGACGACGAAGAGGATGATGCTGATGTCCTCGACTCTTGGGATGCCGCCGAGGACAGTGAGGTCGAGCGCGAGAAGGAGAAGAAGGCTGCTGAGGCC AAGGCCAAGGCTGAGGCTGAGGCCAAGGCAAACCACAAGAGCAAGAGCCAGCGCATAGAAGAGAAGCGCCTGGCGGCCATGCGCAAAAAGATGGAGGAGG ACATGGAGGGCAG BLAST |
Tissue | pods |
Gene name | LI_gene_128672; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_318159
Blastp | Eukaryotic translation initiation factor 3 subunit J from Aspergillus with 70.24% of identity |
---|---|
Blastx | - |
Eggnog | - |
Kegg | Link to kegg annotations (AN5745.2) |
CantataDB | - |
Mirbase | - |
Ncbi protein | - |
Pfam | Translation initiation factor eIF3 subunit (PF08597.9) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |