Id Trinity | TRINITY_DN37389_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_389626 |
Sequence | CCAGAACCAATAACACCAAGGAGATCACAAGACAGGCTGATATTATCATCTCCGCTGTCGGGAAACCGAATATGGTCAGGGGAAGCTGGATAAAACCTGG TGCAGTCATAATCGATGTTGGAATCAACTCAGTAGAGGATTCAAACAGTCCTCAAGGTTATAGATTGGTTGGAGATGTTTGTTTTGAAGAAGCAAGCAAA GTTGCCTCAGCTGTAACGCCAGTTCCAGGAGGAGTTGGACCGATGACAATAGCAATGCTTCTAAAAAATACACTTATCTCTGCAAGATCCACAATTTTGA ATAACACATATGGTCAATTGCAACCTGGTGAAAGCATGTGTATCATTGATTGGTCGGAAC BLAST |
Tissue | pods |
Gene name | LI_gene_128933; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_389626
Blastp | Bifunctional protein FolD 4, chloroplastic from Arabidopsis with 81.05% of identity |
---|---|
Blastx | Bifunctional protein FolD 4, chloroplastic from Arabidopsis with 81.05% of identity |
Eggnog | Catalyzes the oxidation of 5,10- methylenetetrahydrofolate to 5,10-methenyltetrahydrofolate and then the hydrolysis of 5,10-methenyltetrahydrofolate to 10- formyltetrahydrofolate (By similarity)(COG0190) |
Kegg | Link to kegg annotations (AT4G00620) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_016193794.1) |
Pfam | Tetrahydrofolate dehydrogenase/cyclohydrolase, NAD(P)-binding domain (PF02882.18) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |