Id Trinity | TRINITY_DN38230_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_325200 |
Sequence | AAAAACTTCACCATGGGTAAGGTAAAGTGTTCGGAATTGAGGACCAAGGACAAGAAGGACCTCCTGAAACAGTTGGAGGACCTTAAGATGGAGTTGACCA ACTTGAGGGTCGCCAAAGTGACCGGTGGTGCCGCCTCAAAGCTTTCCAAGATCCGTGTTGTCCGTAAGGCTATTGCTCGTGTTTACATCGTCATGCACCA AAAGCAAAAGGAGAACCTTAGGAAATTATACAAAAACAAGAAGTATAAGCCTTTGGACCTTAGACCGAAGAAAACACGTGCGATGAGGAGGGCCCTTACA AAACACGAAAAGAAAATAAAAACGCTâBLAST |
Tissue | pods |
Gene name | LI_gene_129788; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_325200
Blastp | 60S ribosomal protein L35 from Rattus with 76.92% of identity |
---|---|
Blastx | 60S ribosomal protein L35 from Rattus with 82.89% of identity |
Eggnog | 50s ribosomal protein l29(COG0255) |
Kegg | Link to kegg annotations (296709) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_003547464.1) |
Pfam | Ribosomal L29 protein (PF00831.22) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |