Id Trinity | TRINITY_DN38355_c0_g2_i1 |
---|---|
Name Transcript | Ll_transcript_318542 |
Sequence | GCTTATTCCAATACCATTCTCATGGCTTCCCTAGCTTTCAGAAACCAATCCTCTAAGAACCTTCTATTCTCTTTCCGTTTCATATCTTCTTATCATTCAT TTTCTCCAACCAATGCACCTCCATCATGGCCTCCTGTTTCTCTCCACAGATCCATGGCCACTTTTACTAGAACAAAGCCTCATCTCAATGTTGGCACCAT TGGCCATGTCGATCATGGAAAAACCACACTAACTGCTGCAATTACAAAGGTGCTAGCTGATGAAGGTAAAGCCAAGGCAATTGCTTTTGAGGAGATTGAC AAGGCTCCTGAGGAGAAGAAAAGAGGAATTACTATTGCCACGGCTCATGTAGAATATGAGACAGCGAAGAGGCACTATGCCCATGTTGATTGCCCAGGAC ATGCAGATTATGTAAAGAACATGATAACTGGAGCTGCACAAATGGATGGTGG BLAST |
Tissue | pods |
Gene name | LI_gene_129927; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_318542
Blastp | Elongation factor Tu, mitochondrial from Arabidopsis with 71.15% of identity |
---|---|
Blastx | Elongation factor Tu, mitochondrial from Arabidopsis with 71.15% of identity |
Eggnog | This protein promotes the GTP-dependent binding of aminoacyl-tRNA to the A-site of ribosomes during protein biosynthesis (By similarity)(COG0050) |
Kegg | Link to kegg annotations (AT4G02930) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019439770.1) |
Pfam | Elongation factor Tu GTP binding domain (PF00009.26) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |