Id Trinity | TRINITY_DN38839_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_322950 |
Sequence | GTCCTCAAATCTTCAGGACAAAGTCAACAGACGTACCTGCCTCCTGCCTTACACTACATTCCTCCAAAGACTCACCAAAGTGAATCCATCAAAGAGGTGC AAATGGTTCTTTTCCCTATCATGGATGATCTTTTATCCAAAACTAAGACTTCACCCCTTGACATACACATACTTATCATAAACTGCAGTGGCTTTTGTCC CTCACCTTCTCTAACTTCTATTCTCGTAAACAAATACTGTATGAGAAGTGATATCAAAAGCTACAATGTCTCTGGCATGGGGTGCAGTGCAAGTGCTCTA TGTCTTGACATGG BLAST |
Tissue | pods |
Gene name | LI_gene_130419; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_322950
Blastp | 3-ketoacyl-CoA synthase 6 from Arabidopsis with 51.92% of identity |
---|---|
Blastx | 3-ketoacyl-CoA synthase 6 from Arabidopsis with 51.92% of identity |
Eggnog | 3-ketoacyl-coa synthase(ENOG410Y5VH) |
Kegg | Link to kegg annotations (AT1G68530) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019427387.1) |
Pfam | FAE1/Type III polyketide synthase-like protein (PF08392.11) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |