Id Trinity | TRINITY_DN39151_c0_g2_i1 |
---|---|
Name Transcript | Ll_transcript_329282 |
Sequence | GCCCGTGAACTCGAGGAACTCGGCGAGCGTCTCGAGGAGGCTGGCGGTGCTACCTCTGCCCAGATCGAGCTCAACAAGAAGCGCGAGGCTGAGATGGCCA AGCTGCGCCGCGATCTGGAGGAGGCCAACATCCAGCATGAGGGCACCCTCGCCAACCTGCGCAAGAAGCACAACGACGCCGTGGCTGAGATGGGCGAGCA GATCGACCAGCTCAACAAGCTCAAGGCCAAGGTTGAGAAGGACAAGTCCTCCATGGTTGCCGAGCTCAACGACCTCCGTGGATCCGTCGACCACCTCACC AACGAGAAGGCCGCCâBLAST |
Tissue | pods |
Gene name | LI_gene_130741; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_329282
Blastp | Myosin heavy chain, muscle from Sophophora with 76.09% of identity |
---|---|
Blastx | Myosin heavy chain, muscle from Sophophora with 75% of identity |
Eggnog | myosin heavy chain(COG5022) |
Kegg | Link to kegg annotations (Dmel_CG17927) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_013470408.1) |
Pfam | Myosin tail (PF01576.18) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |