Id Trinity | TRINITY_DN39750_c0_g1_i2 |
---|---|
Name Transcript | Ll_transcript_301484 |
Sequence | AGACTTATAATATAGGCAGAGTGTCTGGTTACTAAGCTATGTATCTTGCAGGTTGAAGGTAGCTCTGGTGCTAATAATGGTATGGCAAACACAATCATGC AACAATTTTGGGACTCAGCTTTTGCTCTAGAGCCAGTAGAAGATTATGACACTCATAGTGAAATTTCTGGGTTGCTGTCTTTTGATGGGGCAGATACTAC CAAGTCTATGTGTAAATCTGTTGGGTTTGGAAGTTCATTTGCTTTTAAATTTGAGGATCTCAATGGTCGTGTGCATAGGATCAACTGTGGTGAACATCTT GATGAACTTATATCTGCTATCATGCAAAGAGTTGGTGATGTTAATAATGGAGAACACCCTATAATTTTGTATGAGGATGATGAAGGTGATAAAAT BLAST |
Tissue | pods |
Gene name | LI_gene_131357; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_301484
Blastp | CBS domain-containing protein CBSCBSPB3 from Arabidopsis with 56.48% of identity |
---|---|
Blastx | CBS domain-containing protein CBSCBSPB3 from Arabidopsis with 55.56% of identity |
Eggnog | Catalyzes the conversion of inosine 5'-phosphate (IMP) to xanthosine 5'-phosphate (XMP), the first committed and rate- limiting step in the de novo synthesis of guanine nucleotides, and therefore plays an important role in the regulation of cell growth (By similarity)(COG0517) |
Kegg | Link to kegg annotations (AT3G52950) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019429745.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |