Id Trinity | TRINITY_DN44438_c0_g1_i3 |
---|---|
Name Transcript | Ll_transcript_478281 |
Sequence | AAGATGAAATTTTGAGAAAATATATTCAGGAAAATGGAGAAGGTTCATGGAGGTCATTGCCCAAAAATGCAGGATTACTAAGGTGTGGGAAGAGTTGCAG ATTAAGATGAAATTTTGAGAAAATATATTCAGGAAAATGGAGAAGGTTCATGGAGGTCATTGCCCAAAAATGCAGGATTACTAAGGTGTGGGAAGAGTTG CAGATTAAGATG BLAST |
Tissue | pods |
Gene name | LI_gene_137700; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_478281
Blastp | - |
---|---|
Blastx | Transcription factor MYB12 from Arabidopsis with 52.86% of identity |
Eggnog | Myblike DNAbinding domain containing protein(COG5147) |
Kegg | Link to kegg annotations (AT2G47460) |
CantataDB | Link to cantataDB annotations (CNT0002398) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019426002.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |