Id Trinity | TRINITY_DN44455_c0_g1_i2 |
---|---|
Name Transcript | Ll_transcript_478027 |
Sequence | CTTTATGTCACTGGTATTTCTTCTATCTTCTTCTTTTCCAATTCTCATTCTTCTTTTCTTTTCACTTCACTTTACCCTTCTTTTCTTTTTCTTTCCAATT TTGCAGGATTGCAACCTTCAATTCTCAAGCCAACCAATTTTGGATTCTCTCAAAGTTCAAAATATCCTACTAAACGAAAGGCGAATCCCAGTGCTTCGGG AGCCGTGCAATGCTGCTCATGTCACACAGAAATATTGTATGCAGCTACAATACAGAATTCTCTTGATTCAGATGCCTTGAACACTCTCAAACTAAGCATA CCAGGAACATTATGTCCTTCCACAGATTTCTTCTCCGGGTTGGTTCTTGCCGATCTGGATCCTGGTACTGCCAAGTTAGCTATTGGATTTCTAGGACCAT TTCTCTCAGCTTTTGGTTTTCT BLAST |
Tissue | pods |
Gene name | LI_gene_137728; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_478027
Blastp | Protein COFACTOR ASSEMBLY OF COMPLEX C SUBUNIT B CCB3, chloroplastic from Arabidopsis with 92% of identity |
---|---|
Blastx | Protein COFACTOR ASSEMBLY OF COMPLEX C SUBUNIT B CCB3, chloroplastic from Arabidopsis with 92% of identity |
Eggnog | integral membrane protein(COG0762) |
Kegg | Link to kegg annotations (AT5G36120) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019449789.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |