| Id Trinity | TRINITY_DN44692_c0_g1_i3 |
|---|---|
| Name Transcript | Ll_transcript_283646 |
| Sequence | GCAAAATTCAGAAAAGTTAGGGAAGAATTAAATGAATGGGAAACACTTCAATCTCGCTTAATTTCACAGTTCAGGAATGCTTCTCATATTATTGATAGGT TGCAGATGCTGCAAAATTCAGAAAAGTTAGGGAAGAATTAAATGAATGGGAAACACTTCAATCTCGCTTAATTTCACAGTTCAGGAATGCTTCTCATATT ATTGATAGGTTGCAG BLAST |
| Tissue | pods |
| Gene name | LI_gene_138165; |
| Additional information | - |
| PAB | abscising pods |
| PNAB | non-abscising pods |
| PS1 | seeds stages 1-3 |
| PS2 | seeds stages 4-6 |
| PS3 | seeds stages 7-8 |
| PW1 | pods wall stages 1-3 |
| PW2 | pods wall stages 4-6 |
| PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_283646
| Blastp | - |
|---|---|
| Blastx | Uncharacterized protein At5g43822 from Arabidopsis with 58.14% of identity |
| Eggnog | Pentatricopeptide repeat-containing protein(ENOG410Z7Z7) |
| Kegg | Link to kegg annotations (AT5G43822) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019446258.1) |
| Pfam | - |
| Rfam | - |
| GO | - |