Id Trinity | TRINITY_DN45131_c0_g1_i9 |
---|---|
Name Transcript | Ll_transcript_357722 |
Sequence | TCAAGGGTATTGCCGAGTTCTGCCCCGACGCCTTCGTTCTCGTCATCTCCAACCCCGTCAACAGCACCGTCCCCATTGCCGCCGAGGTCCTCAAGGCCGC CGGCAAGTTCAACCCCAAGAAGCTCTTCGGTGTCACCATTCTCGATGTCGTTCGTGCCGAGACTTTCGTCGCTGAGATCACTGGCGAGACCGACCCCAGC AAGACCACCATCCCCGTTATTGGCGGTCACTCTGGCGAGACCATTGTTCCCCTGTGGAGCCAGGCTAAG BLAST |
Tissue | pods |
Gene name | LI_gene_138983; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_357722
Blastp | - |
---|---|
Blastx | Malate dehydrogenase, glyoxysomal from Cucumis with 65.17% of identity |
Eggnog | - |
Kegg | Link to kegg annotations (101219252) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_020228817.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |