Id Trinity | TRINITY_DN45637_c0_g3_i1 |
---|---|
Name Transcript | Ll_transcript_413286 |
Sequence | CCACTAACGGCTACCGACGCGGCCGTGTCCTCACCGGCCTCCGCCACACCATTGCTTCCGCAGCTTGATTGAGCATCATCCGCCGCAACCGTTGCCGCAG CCACGTGGTTGTCCTCACCTACATGGGCTAGCAATTGTTCCAAATTGCTACGTAGGTAGTTGGCTGTTGTTTCATTTGTTTGTGCTAGCTCCCTCCAAAT TTGATTCTCTACACATAAATTCTTCACTCTTTCTTGAAGTGCCATATTCAGTTTCTCTATTCTTTGAAACTCTTCATCTTTTTCTCTCAATTTCTTAGTC ATTGCCTCTTGGATTGTCCCTAGTAACATCCTTGATTGCCTCATCTTTTGTTCCTC BLAST |
Tissue | pods |
Gene name | LI_gene_140167; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_413286
Blastp | BOI-related E3 ubiquitin-protein ligase 1 from Arabidopsis with 57.52% of identity |
---|---|
Blastx | BOI-related E3 ubiquitin-protein ligase 1 from Arabidopsis with 57.52% of identity |
Eggnog | protein binding zinc ion binding(ENOG4111S1X) |
Kegg | Link to kegg annotations (AT5G45100) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019418110.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |