Id Trinity | TRINITY_DN46351_c2_g2_i4 |
---|---|
Name Transcript | Ll_transcript_365211 |
Sequence | ATTTTAGATGAGATAGAGACAGGTGGTCCTACTGCTATGATGAGATACTGGAATGATGAGGAGGTTTTGCAGAAGTTGGGACAAGCCATGGGCCTTCCAA ATTCTGGTGGTGCAGCTGCTTCTGCTGAAAATTCTGTGCCAGATGAAACAGATGATGTGGGAAATGAAGATGAATCAATTGTTCACCATACTGCTAGTGT TGGTGATGTAGAGGGGTTGAAAAGTGCATTAGCCTCTGGTGCTGACAAGGATGAAGAGGATTCGGAGGGAAGGACTGCTTTGCATTTTTCTTGTGGATAT GGAGAGGTGAAGTGTGCACAAGTTCTCATTGAGGCTGGGGCAAAAGTGGATGCTTTGGATAATAA BLAST |
Tissue | pods |
Gene name | LI_gene_143963; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_365211
Blastp | Ankyrin repeat domain-containing protein 2A from Arabidopsis with 65.35% of identity |
---|---|
Blastx | Ankyrin repeat domain-containing protein 2A from Arabidopsis with 64.57% of identity |
Eggnog | Ankyrin Repeat(COG0666) |
Kegg | Link to kegg annotations (AT4G35450) |
CantataDB | Link to cantataDB annotations (CNT0000133) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019440908.1) |
Pfam | Ankyrin repeats (3 copies) (PF12796.6) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |