Id Trinity | TRINITY_DN46411_c0_g1_i9 |
---|---|
Name Transcript | Ll_transcript_391213 |
Sequence | CAGAGGCGGCGGTGTTAAAATATTTTTCCTTGCTGTGATTTATACTCTACTTGGAGTTCCCCTTTCGTATGTGCTTTGGTACAGGCCTCTCTATCGTGCT ATGAGGACGGATAGCGCATTGAAGTTCACCTGGTTTTTCTTGTTCTACTTGCTTCACATTGCATTTTGTATCTTTGCCGCAATTGCACCTCCAGTTGTTT TTCATGGAAAATCATTAACGGGCATCCTTGCAGCAATTGATGTCTTCTCAGACCATGTATTGGTTGGGATATTCTATTTGGTTGGATTTGGTTTGTTTTG CTTGGAGTCTCTTCTAAGCCTGTGGGTGCTTCAGAAAATATACATGTATTTCCG BLAST |
Tissue | pods |
Gene name | LI_gene_144426; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_391213
Blastp | Secretory carrier-associated membrane protein 4 from Arabidopsis with 82.05% of identity |
---|---|
Blastx | Secretory carrier-associated membrane protein 4 from Arabidopsis with 82.05% of identity |
Eggnog | secretory carrier membrane protein(ENOG410XSJN) |
Kegg | Link to kegg annotations (AT1G32050) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019445255.1) |
Pfam | SCAMP family (PF04144.12) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |