Id Trinity | TRINITY_DN46512_c1_g1_i9 |
---|---|
Name Transcript | Ll_transcript_520769 |
Sequence | CAAAAGGTATTATTATTATTATTATTTACTCAATTTCTGATGTGATTCAATGACTTTGGATTAGTATCTTCTTGTTGTTGATTTTGATTTTTTTCATGTA TTTTTATTGGAATGGGTTTTTGGATGTTTTATTTTTGTTGTTAGAGCTGGTGAATTGACTGCTGCTGAGTTGGATAACATAATGACTGTGGTTGCGAACC CACGACAATTTAAGATCCCGGACTGGTTCTTGAATAGGAAGAAGGATTATAAGGATGGCAAGTTTTCTCAGGTTGTCTCTAATGCCCTCGATATGAAGTT GAGGGATGGCTTGGAGAGACTCAAGAAAATCA BLAST |
Tissue | pods |
Gene name | LI_gene_145176; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_520769
Blastp | - |
---|---|
Blastx | 40S ribosomal protein S18 from Arabidopsis with 88.89% of identity |
Eggnog | Located at the top of the head of the 30S subunit, it contacts several helices of the 16S rRNA. In the 70S ribosome it contacts the 23S rRNA (bridge B1a) and protein L5 of the 50S subunit (bridge B1b), connecting the 2 subunits(COG0099) |
Kegg | Link to kegg annotations (AT1G22780) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019442048.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |