Id Trinity | TRINITY_DN46545_c1_g2_i9 |
---|---|
Name Transcript | Ll_transcript_521566 |
Sequence | CTGGATTGGAAATTCTCGCAGGTTTTCGGAGAACGTACGGCAGGGGAAGAGGTTCAAGAAGGTGATTGTTTAACGTTGTATCTGGTCGTGTGAAAAAAAA TATGTTTTTATTCTTGTCGGATCCAAATATTCTATTGATGTATTTGGATTAGGGTTTGATTCGAACTGTTCTGGATCGTGTTTTTTTACTCCCGTGTTGT TTATGCTTCCGGGTTGTTGAGTAATGCTTGCTTTGGCTCATGGGTCATTGTGTTAATCGT BLAST |
Tissue | pods |
Gene name | LI_gene_145400; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_521566
Blastp | - |
---|---|
Blastx | Serine/threonine protein phosphatase 2A 55 kDa regulatory subunit B beta isoform from Arabidopsis with 76% of identity |
Eggnog | protein phosphatase type 2A regulator activity(COG5170) |
Kegg | Link to kegg annotations (AT1G17720) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_017425134.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |