Id Trinity | TRINITY_DN46569_c1_g1_i6 |
---|---|
Name Transcript | Ll_transcript_520972 |
Sequence | CAACCTCATTCTCAGTTTCTCCTATGTTCTTCTTTCATGGTTGATGATGTTCACCAAGTGGGTCCCACGTTTCATATCAAGTAAAAAATGGAACTTGAAC AATGTGCAATGTTTTTCATCACCCACAAGAGTGAAATCTCCTCTAGAAATGGCTTCAAAGCATGGTGAACTAAGAGTCTTCATTGTTGCTGGAGAAGTTT CTGGAGATTCCATTGCTTCTCGTCTTATGGCTTCTTTGAAACTTCTCTCACCTTTACCTCTTCGTTTTTCTGGTGTTGGAGGGGCTAAAATGTCCAGTGA AGGATTGCAATCTTTGTTCCCTATTGAGGACATCTCAGTAATGGGAATTTGGGAGCTATTACCGCATTTGTATAAATTCAGAGTAAAATTAAAGGAAACT GTAGAAGCAGCTGCTATATTTGAGCCTCATGTAGTAGTAACAGTTGATTCTAAAGGCTTCTCTTTCCGGTTCTTGAAGCAGCTAAGAGCTATATACAGTC AGAAAAAGT BLAST |
Tissue | pods |
Gene name | LI_gene_145551; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_520972
Blastp | Probable lipid-A-disaccharide synthase, mitochondrial from Arabidopsis with 69.7% of identity |
---|---|
Blastx | Probable lipid-A-disaccharide synthase, mitochondrial from Arabidopsis with 69.7% of identity |
Eggnog | Condensation of UDP-2,3-diacylglucosamine and 2,3- diacylglucosamine-1-phosphate to form lipid A disaccharide, a precursor of lipid A, a phosphorylated glycolipid that anchors the lipopolysaccharide to the outer membrane of the cell (By similarity)(COG0763) |
Kegg | Link to kegg annotations (AT2G04560) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019462594.1) |
Pfam | Lipid-A-disaccharide synthetase (PF02684.14) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |