Id Trinity | TRINITY_DN46591_c4_g1_i6 |
---|---|
Name Transcript | Ll_transcript_522172 |
Sequence | AGATTCGATAAAGTTTTATGTTGGCTGTAGACTGCCTAACACATTCTTCACCGGGCTTAGAACTGGCTATGTATAACATCAAACATATATAGGCAGGGCA GGTTTTGTTATATCAAGTGAAAGAATGCAATGATGTATATTTTCTGCTATCCATTTAAATGATGGTATTGATGCTTTTAATTTGGTTTTCACTATTGTTG GAAAGTAACAGATTTTTTATTATTTAATTCTTCTTGTGTTTAGGGTTTGACATCCTCAGGATATCTGTTGGCAATTGATGATGACAATCAAATGTGTGAG CTCCACCCTGATGGCAATAGCTTTGACTTTCTCAAAGGACT BLAST |
Tissue | pods |
Gene name | LI_gene_145725; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_522172
Blastp | - |
---|---|
Blastx | Biotin--protein ligase 1, chloroplastic from Arabidopsis with 69.57% of identity |
Eggnog | Biotin- acetyl-CoA-carboxylase ligase(COG0340) |
Kegg | Link to kegg annotations (AT2G25710) |
CantataDB | Link to cantataDB annotations (CNT0002087) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019433160.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |