Id Trinity | TRINITY_DN46660_c2_g3_i7 |
---|---|
Name Transcript | Ll_transcript_434406 |
Sequence | CTGCACCAGAATGCATTTTAGGTACGGATTGTTTTCAAGCTTGTAATACAATTTTGTTGTATCCTGTTCTCATCGGCTTTTCGTGTCTTATTGATGTTCT AGGTCTTACCTATCATGGCAAAGCTGCAGACACATGGGCAGTAGGAGTTACTTTATACTGTATGATATTGGGTGAATACCCATTTCTCGGAGACACACTT CAAGACACATATGACAGAATAGTCAATAACCCTATAGTACTCCCAAATGATATGAACCCGCAGTTAAAGAACTTAATGGAAGGACTACTTTCCAAAGATC CAAGACTAAGGATGACATTGAATGATGTTGCCGAGCATAGCTGGGTCATCGGAGAT BLAST |
Tissue | pods |
Gene name | LI_gene_146229; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_434406
Blastp | Serine/threonine-protein kinase GRIK2 from Arabidopsis with 66.33% of identity |
---|---|
Blastx | Serine/threonine-protein kinase GRIK2 from Arabidopsis with 66.33% of identity |
Eggnog | Calcium calmodulin-dependent protein kinase kinase(ENOG410YHHF) |
Kegg | Link to kegg annotations (AT5G60550) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019453977.1) |
Pfam | Protein kinase domain (PF00069.24) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |