Id Trinity | TRINITY_DN46869_c0_g1_i1 |
---|---|
Name Transcript | Ll_transcript_511674 |
Sequence | GTTGGAACATATGGCTATATGTCTTCAGAATATGCAATGTATGGAAGATTTTCAGAAAAATCGGATGTATTTAGTTTCGGAGTCATACTTCTGGAGATAA TTAGTGCAAAGCGGAATACTCATTCTATTTTGTCAGATGATGTTGAATACCTCTTGAGTTATGCATGGAGACAATGGAGGGATCAAACACCAATAGAAAT ATTAGACCAAGATATTAAAGAATGTTGCAATGAAAGTGAAGTGATTAAGTGCATTCAAGTTGGTTTATTATGTGTACAAGATAAAGCAGATGATAGACCT ACTATGGCAAAAGTTGTTTCATATTTCAGTAATTCTGACTCTGAAGCTGTGTTGCCATTTCCTGGAGAACCAATAAATTCTATGCATGATCAAATATTGC AAAAGACAGTAGCAGCAGGGGAGTC BLAST |
Tissue | pods |
Gene name | LI_gene_147843; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_511674
Blastp | Cysteine-rich receptor-like protein kinase 10 from Arabidopsis with 42.86% of identity |
---|---|
Blastx | Cysteine-rich receptor-like protein kinase 10 from Arabidopsis with 47.58% of identity |
Eggnog | Serine Threonine protein kinase(COG0515) |
Kegg | Link to kegg annotations (AT4G23180) |
CantataDB | Link to cantataDB annotations (CNT0000159) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019427245.1) |
Pfam | Protein tyrosine kinase (PF07714.16) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |