Id Trinity | TRINITY_DN46893_c2_g3_i8 |
---|---|
Name Transcript | Ll_transcript_512485 |
Sequence | ATGGTTATAAACACAGAATGGGGTAATTTTGGATCCACACACCTTCCTCTAACTGAATATGATCAAGCTCTAGATGCTGAGAGCTTAAACCCTGGTGAAC AGATTTATGAGAAGTTGATTTCGGGTATGTATTTGGGGGACATTGTAAGAAGAGTTTTACTGAAGTTGGCTGAAGAAGCTGACTTTTTTGGAGATACTGT CCCCCCCAAGTTGAGAGTTCCTTTCATAATTAGGACACCCGACATGTCCGCCATGCACCACGACACATCTCCAGATCTGAAAGTGGTTGGAAACAAATTT AGGGACATATTAGAGATATCTAACACATCCTTAAAAA BLAST |
Tissue | pods |
Gene name | LI_gene_148020; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_512485
Blastp | Hexokinase-2 from Arabidopsis with 77.68% of identity |
---|---|
Blastx | Hexokinase-2 from Arabidopsis with 77.68% of identity |
Eggnog | hexokinase(COG5026) |
Kegg | Link to kegg annotations (AT2G19860) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019446376.1) |
Pfam | Hexokinase (PF03727.15) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |