Ll_transcript_372618

• Id Trinity: TRINITY_DN47077_c2_g3_i2
• Name Transcript: Ll_transcript_372618
• Sequence: AGTTCGTGCCAATATGAGAGCGGGAGGACTGACAGATTCGGCAGTAGTATCATCTTTACTTGAGTCGGTGGAAAGTTCTGATCTTATTGCATATGGCCTC ATACCAGAGTTTATTGGACGATTTCCCATCTTAGTCAGCCTGTCAGCTTTAACTGAAGATCAACTTATGCTGGTCCTTACAGAGCCGAAAAATGCTCTTA GTAAGCAGTACAAGAAATTATTTAGCATGAATAATGTTAAGCTATACTTCACAGAGAAAGCTCTAAGATTAATTGCGAAGAAAGCTATGGCCAAAAATAC TGGTGCCAGGGGTTTAAGAGCCCTATTGGAAAGCATTTTAACCGAAGCCAT
• Tissue: pods
• Gene name: LI_gene_149586;
• Additional information: details;

Expression of Ll_transcript_372618

FPKM

• PAB: 5.7
• PNAB: 9.9
• PS1: 10.4
• PS2: 5
• PS3: 10.3
• PW1: 6.6
• PW2: 8
• PW3: 4.7

Labels

• PAB: abscising pods
• PNAB: non-abscising pods
• PS1: seeds stages 1-3
• PS2: seeds stages 4-6
• PS3: seeds stages 7-8
• PW1: pods wall stages 1-3
• PW2: pods wall stages 4-6
• PW3: pods wall stages 7-8

Annotations of Ll_transcript_372618

• Blastp: CLP protease regulatory subunit CLPX1, mitochondrial from Arabidopsis with 79.31% of identity
• Blastx: CLP protease regulatory subunit CLPX1, mitochondrial from Arabidopsis with 79.31% of identity
• Eggnog: ATP-dependent specificity component of the Clp protease. It directs the protease to specific substrates. Can perform chaperone functions in the absence of ClpP (By similarity)(COG1219)
• Kegg: Link to kegg annotations (AT5G53350)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_014624575.1)
• Pfam: C-terminal, D2-small domain, of ClpB protein (PF10431.8)
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;