Id Trinity | TRINITY_DN47077_c2_g3_i3 |
---|---|
Name Transcript | Ll_transcript_372641 |
Sequence | AGTTCGTGCCAATATGAGAGCGGGAGGACTGACAGATTCGGCAGTAGTATCATCTTTACTTGAGTCGAGTTTATTGGACGATTTCCCATCTTAGTCAGCC TGTCAGCTTTAACTGAAGATCAACTTATGCTGGTCCTTACAGAGCCGAAAAATGCTCTTAGTAAGCAGTACAAGAAATTATTTAGCATGAATAATGTTAA GCTATACTTCACAGAGAAAGCTCTAAGATTAATTGCGAAGAAAGCTATGGCCAAAAATACTGGTGCCAGGGGTTTAAGAGCCCTATTGGAAAGCATTTTA ACCGAAGCCATâBLAST |
Tissue | pods |
Gene name | LI_gene_149586; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_372641
Blastp | - |
---|---|
Blastx | CLP protease regulatory subunit CLPX3, mitochondrial from Arabidopsis with 86.42% of identity |
Eggnog | ATP-dependent specificity component of the Clp protease. It directs the protease to specific substrates. Can perform chaperone functions in the absence of ClpP (By similarity)(COG1219) |
Kegg | Link to kegg annotations (AT1G33360) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019453239.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |