Id Trinity | TRINITY_DN47190_c0_g1_i18 |
---|---|
Name Transcript | Ll_transcript_310500 |
Sequence | GTTATCTTGAACTTTCTATACTTAATAGACTACAAAAGGTGTCTTATTGTAATGTAAATTGAAATCTCTTCTGATTAACTGTTTTGCTGTTTCCACTTTC CAGGATTAGCTATTTGGACATTTTCAAGGTTGTGGAACTAACATGTGAGAAGCATCAAAATGAGTTGGTAACATCACCTTCCCTTGAGGAAATTGTTCAC TATGACCA BLAST |
Tissue | pods |
Gene name | LI_gene_150594; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_310500
Blastp | - |
---|---|
Blastx | 1-deoxy-D-xylulose 5-phosphate reductoisomerase, chloroplastic from Arabidopsis with 91.43% of identity |
Eggnog | Catalyzes the NADP-dependent rearrangement and reduction of 1-deoxy-D-xylulose-5-phosphate (DXP) to 2-C-methyl-D-erythritol 4-phosphate (MEP) (By similarity)(COG0743) |
Kegg | Link to kegg annotations (AT5G62790) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019456932.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |