| Id Trinity | TRINITY_DN47205_c2_g2_i8 |
|---|---|
| Name Transcript | Ll_transcript_385385 |
| Sequence | GCCTCTTCAAGGATGCAGACAAGCGCCTTCGGAAAGTCTAAAGGGCTATTGAAAACCCTTGCAGAAGGCAATTGGAGTGATGCATTTGATGGCCTTAGCA TTTCCTTGCTGCTGACCTCAAACCCCGCAATTCAGTATACAGTTTTTGATCAGCTGTAACATCGAGCGCTGAAGAATAAACCAAATCGAGTTGGTCAAAC CGTATCACCAGCATCCCTTCATGCATT BLAST |
| Tissue | pods |
| Gene name | LI_gene_150729; |
| Additional information | - |
| PAB | abscising pods |
| PNAB | non-abscising pods |
| PS1 | seeds stages 1-3 |
| PS2 | seeds stages 4-6 |
| PS3 | seeds stages 7-8 |
| PW1 | pods wall stages 1-3 |
| PW2 | pods wall stages 4-6 |
| PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_385385
| Blastp | - |
|---|---|
| Blastx | Peroxisomal adenine nucleotide carrier 1 from Soja with 82.67% of identity |
| Eggnog | peroxisomal membrane protein(ENOG410ZNC0) |
| Kegg | Link to kegg annotations (100301879) |
| CantataDB | - |
| Mirbase | - |
| Ncbi protein | Link to NCBI protein (XP_019428054.1) |
| Pfam | - |
| Rfam | - |
| GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |