Id Trinity | TRINITY_DN47222_c2_g1_i4 |
---|---|
Name Transcript | Ll_transcript_384170 |
Sequence | CAACGACCCCGCTGTCTAGGTCGCCATCATGCAGATTTTCGTGAAGACCCTCACGGGCAAGACTATCACCCTCGAGGTGGAGTCATCCGACACCATTGAC AATGTCAAGTCCAAGATCCAGGACAAGGAGGGTATCCCCCCGGACCAACAGCGCCTGATCTTCGCTGGTAAGCAGCTCGAGGATGGCCGTACCCTCTCCG ACTACAACATCCAGAAGGAGAGCACTCTTCACCTCGTCCTCCGCCTCCGTGGTGGTGGAAAGAAGCGCAAGAAGAAGGTCTACACCACCCCCAAGAAGAT CAAGCACAAGCGCAAGAAGACCAAGCTGGCCGTCCTCAAGTACTACAAGGTCGACCGTGAAGGCAA BLAST |
Tissue | pods |
Gene name | LI_gene_150827; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_384170
Blastp | Ubiquitin-40S ribosomal protein S27a from Kluyveromyces with 95.54% of identity |
---|---|
Blastx | Ubiquitin-40S ribosomal protein S31 from Saccharomyces with 96.43% of identity |
Eggnog | ubiquitin(COG5272) |
Kegg | Link to kegg annotations (KLLA0D18304g) |
CantataDB | Link to cantataDB annotations (CNT0000474) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_003613203.1) |
Pfam | Ubiquitin-2 like Rad60 SUMO-like (PF11976.7) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |