Id Trinity | TRINITY_DN47330_c0_g1_i5 |
---|---|
Name Transcript | Ll_transcript_501858 |
Sequence | TGAGAAAGTCGATTACTTCAACCTTCCTTGTCCCATTCCCTTCGAGGAGCTTCACCGTGAAGCTATGAGTCTGTTTTCTCTTCCCACCCTTTTTCTTCTT ATTCACAATTTTATTCATTTTAATGTCCATTTCTCGTTTTAATTCATCGAAACTTAAGCTTTAAATGCAAAGTTAGGATTTTTATTTTCTGGGGTTTCAT TGTTCTAATCATATGTTTGTATGAGTATATGACACTTTAATTTGTTTCTGAGCAGTGTCTTTGAAGCCAGATCTTTTT BLAST |
Tissue | pods |
Gene name | LI_gene_151753; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_501858
Blastp | - |
---|---|
Blastx | Mitochondrial import receptor subunit TOM40-1 from Arabidopsis with 77.78% of identity |
Eggnog | Translocase of outer mitochondrial membrane 40 homolog(ENOG410XS2U) |
Kegg | Link to kegg annotations (AT3G20000) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019437444.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |