Id Trinity | TRINITY_DN47428_c3_g11_i1 |
---|---|
Name Transcript | Ll_transcript_476493 |
Sequence | GGTTAACTGGAGCTTCTTACTATACATGATGGAAAGGATGAGCTTTTGTATTAGACGGAAGAATTGGATCAAGAGTTGTCTTCAGTCTAACTCAGTGTCC ATCTTGGTTAATGGCAGCCCAACATCGGAGTTCTCTATGTGCAGAGGATTGAGACAAGGTGATCTGATTGCACCTTTCCTATTTATTATTGTTGCCAAGG GCATGGCTGGTTTGATGATGTCTGTGGATTCTAAGAAGATTTACAACTGTTACCCGGTTGGTAGAGATCGTGTTGTTGTTTCCCATATCCAGTATGCTGA TGATACTCTTCTTATTGGTAAGAACTCTACCGATAATATTGTGGTTCTTAAAGGCATTCTA BLAST |
Tissue | pods |
Gene name | LI_gene_152505; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_476493
Blastp | Uncharacterized mitochondrial protein AtMg01250 from Arabidopsis with 31.88% of identity |
---|---|
Blastx | Uncharacterized mitochondrial protein AtMg01250 from Arabidopsis with 31.88% of identity |
Eggnog | Retrotransposon protein(ENOG410Y65V) |
Kegg | Link to kegg annotations (ArthMp102) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019429814.1) |
Pfam | Reverse transcriptase (RNA-dependent DNA polymerase) (PF00078.26) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |