Id Trinity | TRINITY_DN47504_c0_g1_i5 |
---|---|
Name Transcript | Ll_transcript_527391 |
Sequence | GTTCACTTCAATTGTTTAAGTTTCTTTTTTCTAGAATTTGAAATTTGTATGCTTTTGTCGTTTTTTCATTATTCCTTTTTCTTGTTTTGCTGTAACTTTG AATTTTGGTAATTGAATCTGAATTCTAAATCCTTGAGCGGCGCATCTTATGTAACAGATTGGTTCTGTCCAAATAGAGGCGTTATATCAATATGCCAAGT TCCAATTTGAGTGTGGTAACTACTCTGGTGCTGCTGATTATCTTTATCAGTACAGGGCTTTGTGCACAAACAGTGAAAGGAGTCTAAGTGCATTGTGGGG AAAGCTGGCGGCTGAAATATTGATGCAAAACTGGGACATTGCTCTTGAAGAGTTGAA BLAST |
Tissue | pods |
Gene name | LI_gene_153191; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_527391
Blastp | - |
---|---|
Blastx | Eukaryotic translation initiation factor 3 subunit E from Arabidopsis with 91.04% of identity |
Eggnog | Component of the eukaryotic translation initiation factor 3 (eIF-3) complex, which is involved in protein synthesis and, together with other initiation factors, stimulates binding of mRNA and methionyl-tRNAi to the 40S ribosome (By similarity)(ENOG410XQK5) |
Kegg | Link to kegg annotations (AT3G57290) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019417248.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |