Id Trinity | TRINITY_DN47509_c4_g1_i8 |
---|---|
Name Transcript | Ll_transcript_525990 |
Sequence | ATGTTTGAAAGGGTTAGCATCCAAAGTTGTGAAAGCAACTCCGGGAAGAGCGAAGAAAATTATGACCGACTTGGAAGAAAGGCTATATATGCTTTTATTT ATCCAAACTTCATGATTAATAGGTGCTTCCTTTGTTATCTTACTGATGCTAAAATGAATTTGGTATCTTCCATGTGTTTTTTTGTGAAAAATAGCATGCT ATATCATGACTTGAAGTCTTTTGTGGCCTGACAGGTATGGACCTTGGATGGACACCAATCTCGTACTTCCACTAGGACCCAACAAATGTCAAGTAGTATT TGACTACTATCTTGATCATTCTCTAAAG BLAST |
Tissue | pods |
Gene name | LI_gene_153246; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_525990
Blastp | - |
---|---|
Blastx | Choline monooxygenase, chloroplastic from Arabidopsis with 84.85% of identity |
Eggnog | rieske 2fe-2S domain-containing protein(COG4638) |
Kegg | Link to kegg annotations (AT4G29890) |
CantataDB | Link to cantataDB annotations (CNT0000705) |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_017410377.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |