Id Trinity | TRINITY_DN47607_c1_g3_i19 |
---|---|
Name Transcript | Ll_transcript_361343 |
Sequence | GAAATCACACCCCTTGATAGATGGGTTCATTCCTACTATTGAAGGAGAAGATGGGATTTGTTATACCCATCCTGAGAGACTTCCAGGTCTTAGATATTAA CTTAGCAAAATTGAAATACCCTCTAATTCTCAACCACATGCATTGATTTGGATGTGCTTAACCATTTGGTCATAGACCATGTAATAATTTATCATATCGG ATATTAGGTACAGCTAAGTA BLAST |
Tissue | pods |
Gene name | LI_gene_154003; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_361343
Blastp | - |
---|---|
Blastx | NAC domain-containing protein 10 from Arabidopsis with 80% of identity |
Eggnog | No apical meristem (NAM) protein(ENOG41108VG) |
Kegg | Link to kegg annotations (AT1G28470) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019457337.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |