Ll_transcript_359616

• Id Trinity: TRINITY_DN47651_c4_g2_i9
• Name Transcript: Ll_transcript_359616
• Sequence: ATTACTCAATAATTGTAAAAATCGCTTAAATTATAAGTCACAGCTTTTTATTCATCAGAAATTTAGATTGTATTGCTCTTCAAGGATCGCTCATTCATTG AGAGAGAAATCGAAAACGAGTGTTCATCTACACTCACTCATTCATCCTGATATATGATGTCAAAAAGTGCTAGGGCATGTATTTGTATACGCATTCCCGG ACGCGTGATTGGGGAGTCTTCAAGTTACATAGCAGCTGATGACAGCTCCTCTGCAAGTTCTGAAGACAAGCAAGATGAAACATTAGGGTTCTGGTATATG TCTAGGAAAGAAATAGTGGAGAATTCTCCGTCAAGAAAAGATGGCATCGACTGGAAGAAAGAGACATTTTACCGCAAGTCATACTGCACATTTTTACAGG AGTTAGGAATAAAACTTAAAGTGCCTCAGATAACTATAGCAACAGCAATAATCTTTTGTCATCGGTTCTTTCTTCAACATTCTCATGCAAAGAACGATCG AAGGACCATTGCAACTGTCTGTATGTTCCTTGCTGGGAAGGTTGAAGAGACTCCTCGTCCACTAAA
• Tissue: pods
• Gene name: LI_gene_154385;
• Additional information: details;

Expression of Ll_transcript_359616

FPKM

• PAB: 0.2
• PNAB: 2
• PS1: 0.9
• PS2: 2
• PS3: 1.6
• PW1: 1
• PW2: 0
• PW3: 1.1

Labels

• PAB: abscising pods
• PNAB: non-abscising pods
• PS1: seeds stages 1-3
• PS2: seeds stages 4-6
• PS3: seeds stages 7-8
• PW1: pods wall stages 1-3
• PW2: pods wall stages 4-6
• PW3: pods wall stages 7-8

Annotations of Ll_transcript_359616

• Blastp: Cyclin-T1-5 from Arabidopsis with 70.16% of identity
• Blastx: Cyclin-T1-4 from Oryza sativa with 83.52% of identity
• Eggnog: Component of the Mediator complex, a coactivator involved in regulated gene transcription of nearly all RNA polymerase II-dependent genes. Mediator functions as a bridge to convey information from gene-specific regulatory proteins to the basal RNA polymerase II transcription machinery. Mediator is recruited to promoters by direct interactions with regulatory proteins and serves as a scaffold for the assembly of a functional preinitiation complex with RNA polymerase II and the general transcription factors. Binds to and activates cyclin-dependent kinase cdk8 that phosphorylates the CTD (C-terminal domain) of the large subunit of RNA polymerase II (RNAp II), which may inhibit the formation of a transcription initiation complex(COG5333)
• Kegg: Link to kegg annotations (AT5G45190)
• CantataDB: -
• Mirbase: -
• Ncbi protein: Link to NCBI protein (XP_019440088.1)
• Pfam: Cyclin, N-terminal domain (PF00134.22)
• Rfam: -
• GO: Links to GO: General; Genes and gene products; Annotations; Ontology;