Id Trinity | TRINITY_DN47729_c7_g1_i10 |
---|---|
Name Transcript | Ll_transcript_374083 |
Sequence | ATGGCCAAATCAGAGGTCTGCATTCAACTATCCTTTTATATTTATCACACTGCAATCAACAACTTATTTTTTCTTCTGTAAAAATCCAGGTATACCTATA GGCTGGGACATATTTTGTCTAATGGTTCTTACGTCAAGAGTAAGAAGTATTCGTTCAAGGGAGCACCATATCCTGGACAAAACTCATTGCAGCGTGTTAT CATATTCGGTGACATGGGAAAGG BLAST |
Tissue | pods |
Gene name | LI_gene_154975; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_374083
Blastp | - |
---|---|
Blastx | Probable inactive purple acid phosphatase 27 from Arabidopsis with 58.06% of identity |
Eggnog | Hydrolyzes cAMP to 5'-AMP. Plays an important regulatory role in modulating the intracellular concentration of cAMP, thereby influencing cAMP-dependent processes (By similarity)(COG1409) |
Kegg | Link to kegg annotations (AT5G50400) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019417627.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |