Id Trinity | TRINITY_DN48057_c4_g2_i1 |
---|---|
Name Transcript | Ll_transcript_327948 |
Sequence | CTTGTAGACCCAATGATACAGCCATTCCCAAAAAGCTATAGAGGAGAAGCATTTTCCTTCCAAGTTTATCCATCAGAATAATTGCAAGAATTGGCCCCAA TAAATTGCAAATTCCTAAACACGTGTTCCCTATATGTGATGAGACATCAAAGCTTTTGAAAATGGCTGAAGAGAAATAGAAAGCTGAAGGTGAAGAGGGA ATACAAGâBLAST |
Tissue | pods |
Gene name | LI_gene_157836; |
Additional information | - |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_327948
Blastp | - |
---|---|
Blastx | Probable plastidic glucose transporter 3 from Arabidopsis with 64.15% of identity |
Eggnog | Transporter(ENOG410XNQK) |
Kegg | Link to kegg annotations (AT1G79820) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_019436437.1) |
Pfam | - |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; |