Id Trinity | TRINITY_DN48103_c0_g1_i5 |
---|---|
Name Transcript | Ll_transcript_509221 |
Sequence | AACATGAACCCTCTTGGGAAGGTCCCTGTCTTGGAAACTCCACATGCTCCTGTTTTTGAGAGCAATGCCATTGCTCGTTATGGTAACCTACCCACTCTTA CATTTCCTTTATGTATATTCTCATCACTCATCACTAATATTCAATATTCAATACTCCCCCCCAGTTGCACGATCCAACCCTCACACCTCTTTGCTTGGAT CTTCTCCCATTCAACAGGTTCCCTTATCATTCACTCATTTCATTTCTTCTTTATCTTCTCCCATTCAACAGGTTCCCTTATCATTCACTCATTTCATTTC TTCTTTATCTTCTCCCATTCAACAGGTTC BLAST |
Tissue | pods |
Gene name | LI_gene_158225; |
Additional information | details; |
PAB | abscising pods |
PNAB | non-abscising pods |
PS1 | seeds stages 1-3 |
PS2 | seeds stages 4-6 |
PS3 | seeds stages 7-8 |
PW1 | pods wall stages 1-3 |
PW2 | pods wall stages 4-6 |
PW3 | pods wall stages 7-8 |
Annotations of Ll_transcript_509221
Blastp | Probable elongation factor 1-gamma 2 from Arabidopsis with 84.62% of identity |
---|---|
Blastx | Elongation factor 1-gamma 1 from Oryza sativa with 84.62% of identity |
Eggnog | glutathione Stransferase(COG0625) |
Kegg | Link to kegg annotations (AT1G57720) |
CantataDB | - |
Mirbase | - |
Ncbi protein | Link to NCBI protein (XP_020221597.1) |
Pfam | Glutathione S-transferase, N-terminal domain (PF02798.19) |
Rfam | - |
GO | Links to GO: General; Genes and gene products; Annotations; Ontology; Links to GO: General; Genes and gene products; Annotations; Ontology; |